data_53263 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 53263 _Entry.Title ; DNA_CTD_BsParB_Relaxation ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2025-07-09 _Entry.Accession_date 2025-07-09 _Entry.Last_release_date 2025-07-09 _Entry.Original_release_date 2025-07-09 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Aleksey Aleshintsev . . . 0000-0002-6463-0357 53263 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID heteronucl_NOEs 1 53263 heteronucl_T1_relaxation 1 53263 heteronucl_T2_relaxation 1 53263 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID 'T1 relaxation values' 58 53263 'T2 relaxation values' 55 53263 'heteronuclear NOE values' 53 53263 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2025-07-14 . original BMRB . 53263 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 53264 'apo CTD BsParB Relaxation' 53263 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 53263 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; ParB C-terminal lysine residues are essential for dimerization, in vitro DNA sliding, and in vivo function. ; _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Aleksey Aleshintsev . . . . 53263 1 2 Lindsey Way . E. . . 53263 1 3 Bianca Guerra . . . . 53263 1 4 Lois Akosua . S. . . 53263 1 5 Miranda Molina . . . . 53263 1 6 Xindan Wang . . . . 53263 1 7 HyeongJun Kim . . . . 53263 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 53263 _Assembly.ID 1 _Assembly.Name 'BsBarB C-terminal Domain (CTD)' _Assembly.BMRB_code . _Assembly.Number_of_components 2 _Assembly.Organic_ligands 1 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 CTD_BsParB 1 $entity_1 . . yes native no no . . . 53263 1 2 DNA 2 $entity_2 . . no native no no . . . 53263 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 53263 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polypeptide(L) _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; QNVPRETKKKEPVKDAVLKE RESYLQNYFGTTVNIKRQKK KGKIEIEFFSNEDLDRILEL LSERES ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 66 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . GLN . 53263 1 2 . ASN . 53263 1 3 . VAL . 53263 1 4 . PRO . 53263 1 5 . ARG . 53263 1 6 . GLU . 53263 1 7 . THR . 53263 1 8 . LYS . 53263 1 9 . LYS . 53263 1 10 . LYS . 53263 1 11 . GLU . 53263 1 12 . PRO . 53263 1 13 . VAL . 53263 1 14 . LYS . 53263 1 15 . ASP . 53263 1 16 . ALA . 53263 1 17 . VAL . 53263 1 18 . LEU . 53263 1 19 . LYS . 53263 1 20 . GLU . 53263 1 21 . ARG . 53263 1 22 . GLU . 53263 1 23 . SER . 53263 1 24 . TYR . 53263 1 25 . LEU . 53263 1 26 . GLN . 53263 1 27 . ASN . 53263 1 28 . TYR . 53263 1 29 . PHE . 53263 1 30 . GLY . 53263 1 31 . THR . 53263 1 32 . THR . 53263 1 33 . VAL . 53263 1 34 . ASN . 53263 1 35 . ILE . 53263 1 36 . LYS . 53263 1 37 . ARG . 53263 1 38 . GLN . 53263 1 39 . LYS . 53263 1 40 . LYS . 53263 1 41 . LYS . 53263 1 42 . GLY . 53263 1 43 . LYS . 53263 1 44 . ILE . 53263 1 45 . GLU . 53263 1 46 . ILE . 53263 1 47 . GLU . 53263 1 48 . PHE . 53263 1 49 . PHE . 53263 1 50 . SER . 53263 1 51 . ASN . 53263 1 52 . GLU . 53263 1 53 . ASP . 53263 1 54 . LEU . 53263 1 55 . ASP . 53263 1 56 . ARG . 53263 1 57 . ILE . 53263 1 58 . LEU . 53263 1 59 . GLU . 53263 1 60 . LEU . 53263 1 61 . LEU . 53263 1 62 . SER . 53263 1 63 . GLU . 53263 1 64 . ARG . 53263 1 65 . GLU . 53263 1 66 . SER . 53263 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . GLN 1 1 53263 1 . ASN 2 2 53263 1 . VAL 3 3 53263 1 . PRO 4 4 53263 1 . ARG 5 5 53263 1 . GLU 6 6 53263 1 . THR 7 7 53263 1 . LYS 8 8 53263 1 . LYS 9 9 53263 1 . LYS 10 10 53263 1 . GLU 11 11 53263 1 . PRO 12 12 53263 1 . VAL 13 13 53263 1 . LYS 14 14 53263 1 . ASP 15 15 53263 1 . ALA 16 16 53263 1 . VAL 17 17 53263 1 . LEU 18 18 53263 1 . LYS 19 19 53263 1 . GLU 20 20 53263 1 . ARG 21 21 53263 1 . GLU 22 22 53263 1 . SER 23 23 53263 1 . TYR 24 24 53263 1 . LEU 25 25 53263 1 . GLN 26 26 53263 1 . ASN 27 27 53263 1 . TYR 28 28 53263 1 . PHE 29 29 53263 1 . GLY 30 30 53263 1 . THR 31 31 53263 1 . THR 32 32 53263 1 . VAL 33 33 53263 1 . ASN 34 34 53263 1 . ILE 35 35 53263 1 . LYS 36 36 53263 1 . ARG 37 37 53263 1 . GLN 38 38 53263 1 . LYS 39 39 53263 1 . LYS 40 40 53263 1 . LYS 41 41 53263 1 . GLY 42 42 53263 1 . LYS 43 43 53263 1 . ILE 44 44 53263 1 . GLU 45 45 53263 1 . ILE 46 46 53263 1 . GLU 47 47 53263 1 . PHE 48 48 53263 1 . PHE 49 49 53263 1 . SER 50 50 53263 1 . ASN 51 51 53263 1 . GLU 52 52 53263 1 . ASP 53 53 53263 1 . LEU 54 54 53263 1 . ASP 55 55 53263 1 . ARG 56 56 53263 1 . ILE 57 57 53263 1 . LEU 58 58 53263 1 . GLU 59 59 53263 1 . LEU 60 60 53263 1 . LEU 61 61 53263 1 . SER 62 62 53263 1 . GLU 63 63 53263 1 . ARG 64 64 53263 1 . GLU 65 65 53263 1 . SER 66 66 53263 1 stop_ save_ save_entity_2 _Entity.Sf_category entity _Entity.Sf_framecode entity_2 _Entity.Entry_ID 53263 _Entity.ID 2 _Entity.BMRB_code . _Entity.Name entity_2 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GCGTACATCATTCCCTGATG TACGC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer . _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 25 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not available' _Entity.Src_method . _Entity.Parent_entity_ID 2 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . DG . 53263 2 2 . DC . 53263 2 3 . DG . 53263 2 4 . DT . 53263 2 5 . DA . 53263 2 6 . DC . 53263 2 7 . DA . 53263 2 8 . DT . 53263 2 9 . DC . 53263 2 10 . DA . 53263 2 11 . DT . 53263 2 12 . DT . 53263 2 13 . DC . 53263 2 14 . DC . 53263 2 15 . DC . 53263 2 16 . DT . 53263 2 17 . DG . 53263 2 18 . DA . 53263 2 19 . DT . 53263 2 20 . DG . 53263 2 21 . DT . 53263 2 22 . DA . 53263 2 23 . DC . 53263 2 24 . DG . 53263 2 25 . DC . 53263 2 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DG 1 1 53263 2 . DC 2 2 53263 2 . DG 3 3 53263 2 . DT 4 4 53263 2 . DA 5 5 53263 2 . DC 6 6 53263 2 . DA 7 7 53263 2 . DT 8 8 53263 2 . DC 9 9 53263 2 . DA 10 10 53263 2 . DT 11 11 53263 2 . DT 12 12 53263 2 . DC 13 13 53263 2 . DC 14 14 53263 2 . DC 15 15 53263 2 . DT 16 16 53263 2 . DG 17 17 53263 2 . DA 18 18 53263 2 . DT 19 19 53263 2 . DG 20 20 53263 2 . DT 21 21 53263 2 . DA 22 22 53263 2 . DC 23 23 53263 2 . DG 24 24 53263 2 . DC 25 25 53263 2 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 53263 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 562 organism . 'Escherichia coli' 'E. coli' . . Bacteria . Escherichia coli . . . . . . . . . . . . . 53263 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 53263 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'recombinant technology' 'Escherichia coli' . . . Escherichia coli . . . plasmid . . pTG011 . . . 53263 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 53263 _Sample.ID 1 _Sample.Name DNA_CTD _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 CTD_BsParB '[U-100% 15N]' . . 1 $entity_1 . . 0.4 . . mM . . . . 53263 1 2 D2O 'natural abundance' . . . . . . 10 . . % . . . . 53263 1 3 DSS 'natural abundance' . . . . . . 200 . . mM . . . . 53263 1 4 PBS 'natural abundance' . . . . . . 10 . . mM . . . . 53263 1 5 'DNA hairpin' 'natural abundance' . . 2 $entity_2 . . 1.25:1 . . ratio . . . . 53263 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 53263 _Sample_condition_list.ID 1 _Sample_condition_list.Name standard _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID pH 6.1 . pH 53263 1 pressure 1 . atm 53263 1 temperature 308 . K 53263 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 53263 _Software.ID 1 _Software.Type . _Software.Name NMRPipe _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 53263 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 53263 _Software.ID 2 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'data analysis' . 53263 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 53263 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name NMR_500 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE III' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 500 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 53263 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 'T1/R1 relaxation' yes no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53263 1 2 'T2/R2 relaxation' yes . no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53263 1 3 '15N-(1H) NOE' yes . no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53263 1 stop_ loop_ _Experiment_file.Experiment_ID _Experiment_file.Experiment_name _Experiment_file.Name _Experiment_file.Type _Experiment_file.Content _Experiment_file.Directory_path _Experiment_file.Details _Experiment_file.Entry_ID _Experiment_file.Experiment_list_ID 1 'T1/R1 relaxation' Relax_DNA_15N_CTD_T1.zip . 'Time-domain (raw spectral data)' . . 53263 1 2 'T2/R2 relaxation' Relax_DNA_15N_CTD_T2.zip . 'Time-domain (raw spectral data)' . . 53263 1 3 '15N-(1H) NOE' Relax_DNA_15N_CTD_NOE.zip . 'Time-domain (raw spectral data)' . . 53263 1 stop_ save_ ############################## # Heteronuclear NOE values # ############################## save_heteronucl_NOEs_1 _Heteronucl_NOE_list.Sf_category heteronucl_NOEs _Heteronucl_NOE_list.Sf_framecode heteronucl_NOEs_1 _Heteronucl_NOE_list.Entry_ID 53263 _Heteronucl_NOE_list.ID 1 _Heteronucl_NOE_list.Name CTD_ParB_DNA_NOE _Heteronucl_NOE_list.Sample_condition_list_ID 1 _Heteronucl_NOE_list.Sample_condition_list_label $sample_conditions_1 _Heteronucl_NOE_list.Spectrometer_frequency_1H 500 _Heteronucl_NOE_list.Heteronuclear_NOE_val_type 'peak height' _Heteronucl_NOE_list.NOE_ref_val 151000 _Heteronucl_NOE_list.NOE_ref_description . _Heteronucl_NOE_list.Details . _Heteronucl_NOE_list.Text_data_format . _Heteronucl_NOE_list.Text_data . loop_ _Heteronucl_NOE_experiment.Experiment_ID _Heteronucl_NOE_experiment.Experiment_name _Heteronucl_NOE_experiment.Sample_ID _Heteronucl_NOE_experiment.Sample_label _Heteronucl_NOE_experiment.Sample_state _Heteronucl_NOE_experiment.Entry_ID _Heteronucl_NOE_experiment.Heteronucl_NOE_list_ID 3 '15N-(1H) NOE' . . . 53263 1 stop_ loop_ _Heteronucl_NOE_software.Software_ID _Heteronucl_NOE_software.Software_label _Heteronucl_NOE_software.Method_ID _Heteronucl_NOE_software.Method_label _Heteronucl_NOE_software.Entry_ID _Heteronucl_NOE_software.Heteronucl_NOE_list_ID 2 $software_2 . . 53263 1 stop_ loop_ _Heteronucl_NOE.ID _Heteronucl_NOE.Assembly_atom_ID_1 _Heteronucl_NOE.Entity_assembly_ID_1 _Heteronucl_NOE.Entity_ID_1 _Heteronucl_NOE.Comp_index_ID_1 _Heteronucl_NOE.Seq_ID_1 _Heteronucl_NOE.Comp_ID_1 _Heteronucl_NOE.Atom_ID_1 _Heteronucl_NOE.Atom_type_1 _Heteronucl_NOE.Atom_isotope_number_1 _Heteronucl_NOE.Assembly_atom_ID_2 _Heteronucl_NOE.Entity_assembly_ID_2 _Heteronucl_NOE.Entity_ID_2 _Heteronucl_NOE.Comp_index_ID_2 _Heteronucl_NOE.Seq_ID_2 _Heteronucl_NOE.Comp_ID_2 _Heteronucl_NOE.Atom_ID_2 _Heteronucl_NOE.Atom_type_2 _Heteronucl_NOE.Atom_isotope_number_2 _Heteronucl_NOE.Val _Heteronucl_NOE.Val_err _Heteronucl_NOE.Resonance_ID_1 _Heteronucl_NOE.Resonance_ID_2 _Heteronucl_NOE.Auth_entity_assembly_ID_1 _Heteronucl_NOE.Auth_seq_ID_1 _Heteronucl_NOE.Auth_comp_ID_1 _Heteronucl_NOE.Auth_atom_ID_1 _Heteronucl_NOE.Auth_entity_assembly_ID_2 _Heteronucl_NOE.Auth_seq_ID_2 _Heteronucl_NOE.Auth_comp_ID_2 _Heteronucl_NOE.Auth_atom_ID_2 _Heteronucl_NOE.Entry_ID _Heteronucl_NOE.Heteronucl_NOE_list_ID 1 . 1 1 6 6 GLU N N 15 . 1 1 6 6 GLU H H 1 -0.33221744 0.032305684 . . . . . . . . . . 53263 1 2 . 1 1 7 7 THR N N 15 . 1 1 7 7 THR H H 1 -0.386800895 0.047157768 . . . . . . . . . . 53263 1 3 . 1 1 8 8 LYS N N 15 . 1 1 8 8 LYS H H 1 -0.222839596 0.027246491 . . . . . . . . . . 53263 1 4 . 1 1 9 9 LYS N N 15 . 1 1 9 9 LYS H H 1 -0.210188294 0.026923323 . . . . . . . . . . 53263 1 5 . 1 1 10 10 LYS N N 15 . 1 1 10 10 LYS H H 1 -0.096790006 0.026492283 . . . . . . . . . . 53263 1 6 . 1 1 11 11 GLU N N 15 . 1 1 11 11 GLU H H 1 -0.105839646 0.026655152 . . . . . . . . . . 53263 1 7 . 1 1 13 13 VAL N N 15 . 1 1 13 13 VAL H H 1 -0.001021529 0.023908326 . . . . . . . . . . 53263 1 8 . 1 1 14 14 LYS N N 15 . 1 1 14 14 LYS H H 1 0.138638019 0.063284504 . . . . . . . . . . 53263 1 9 . 1 1 16 16 ALA N N 15 . 1 1 16 16 ALA H H 1 0.422976879 0.156207537 . . . . . . . . . . 53263 1 10 . 1 1 17 17 VAL N N 15 . 1 1 17 17 VAL H H 1 0.779474548 0.221154699 . . . . . . . . . . 53263 1 11 . 1 1 18 18 LEU N N 15 . 1 1 18 18 LEU H H 1 0.683348018 0.224694441 . . . . . . . . . . 53263 1 12 . 1 1 19 19 LYS N N 15 . 1 1 19 19 LYS H H 1 0.644553571 0.222537152 . . . . . . . . . . 53263 1 13 . 1 1 20 20 GLU N N 15 . 1 1 20 20 GLU H H 1 0.655576037 0.231231080 . . . . . . . . . . 53263 1 14 . 1 1 21 21 ARG N N 15 . 1 1 21 21 ARG H H 1 0.937200504 0.369347828 . . . . . . . . . . 53263 1 15 . 1 1 22 22 GLU N N 15 . 1 1 22 22 GLU H H 1 0.885535650 0.342895873 . . . . . . . . . . 53263 1 16 . 1 1 23 23 SER N N 15 . 1 1 23 23 SER H H 1 0.988127854 0.274419316 . . . . . . . . . . 53263 1 17 . 1 1 24 24 TYR N N 15 . 1 1 24 24 TYR H H 1 0.597969991 0.213851018 . . . . . . . . . . 53263 1 18 . 1 1 25 25 LEU N N 15 . 1 1 25 25 LEU H H 1 0.732019840 0.361377899 . . . . . . . . . . 53263 1 19 . 1 1 26 26 GLN N N 15 . 1 1 26 26 GLN H H 1 0.645295155 0.258690969 . . . . . . . . . . 53263 1 20 . 1 1 27 27 ASN N N 15 . 1 1 27 27 ASN H H 1 0.712679426 0.206860656 . . . . . . . . . . 53263 1 21 . 1 1 28 28 TYR N N 15 . 1 1 28 28 TYR H H 1 0.946051507 0.359102945 . . . . . . . . . . 53263 1 22 . 1 1 29 29 PHE N N 15 . 1 1 29 29 PHE H H 1 0.748943874 0.319628809 . . . . . . . . . . 53263 1 23 . 1 1 30 30 GLY N N 15 . 1 1 30 30 GLY H H 1 0.803146509 0.268335628 . . . . . . . . . . 53263 1 24 . 1 1 31 31 THR N N 15 . 1 1 31 31 THR H H 1 0.792123951 0.175115047 . . . . . . . . . . 53263 1 25 . 1 1 33 33 VAL N N 15 . 1 1 33 33 VAL H H 1 0.761751794 0.285601132 . . . . . . . . . . 53263 1 26 . 1 1 34 34 ASN N N 15 . 1 1 34 34 ASN H H 1 1.082134915 0.466287982 . . . . . . . . . . 53263 1 27 . 1 1 35 35 ILE N N 15 . 1 1 35 35 ILE H H 1 0.462310606 0.210282434 . . . . . . . . . . 53263 1 28 . 1 1 36 36 LYS N N 15 . 1 1 36 36 LYS H H 1 0.966709512 0.382126466 . . . . . . . . . . 53263 1 29 . 1 1 37 37 ARG N N 15 . 1 1 37 37 ARG H H 1 0.450883838 0.139112269 . . . . . . . . . . 53263 1 30 . 1 1 39 39 LYS N N 15 . 1 1 39 39 LYS H H 1 0.454756554 0.165491751 . . . . . . . . . . 53263 1 31 . 1 1 40 40 LYS N N 15 . 1 1 40 40 LYS H H 1 0.643810680 0.151171603 . . . . . . . . . . 53263 1 32 . 1 1 41 41 LYS N N 15 . 1 1 41 41 LYS H H 1 0.419753086 0.076088314 . . . . . . . . . . 53263 1 33 . 1 1 42 42 GLY N N 15 . 1 1 42 42 GLY H H 1 0.886849853 0.280061358 . . . . . . . . . . 53263 1 34 . 1 1 44 44 ILE N N 15 . 1 1 44 44 ILE H H 1 0.863744884 0.480791587 . . . . . . . . . . 53263 1 35 . 1 1 45 45 GLU N N 15 . 1 1 45 45 GLU H H 1 0.762321044 0.338030922 . . . . . . . . . . 53263 1 36 . 1 1 46 46 ILE N N 15 . 1 1 46 46 ILE H H 1 0.794980624 0.501345838 . . . . . . . . . . 53263 1 37 . 1 1 47 47 GLU N N 15 . 1 1 47 47 GLU H H 1 0.502380700 0.241281457 . . . . . . . . . . 53263 1 38 . 1 1 48 48 PHE N N 15 . 1 1 48 48 PHE H H 1 0.836654398 0.352703858 . . . . . . . . . . 53263 1 39 . 1 1 49 49 PHE N N 15 . 1 1 49 49 PHE H H 1 0.624457701 0.333845052 . . . . . . . . . . 53263 1 40 . 1 1 50 50 SER N N 15 . 1 1 50 50 SER H H 1 0.548640916 0.168050986 . . . . . . . . . . 53263 1 41 . 1 1 52 52 GLU N N 15 . 1 1 52 52 GLU H H 1 0.730973097 0.262158163 . . . . . . . . . . 53263 1 42 . 1 1 54 54 LEU N N 15 . 1 1 54 54 LEU H H 1 0.929789249 0.345474028 . . . . . . . . . . 53263 1 43 . 1 1 55 55 ASP N N 15 . 1 1 55 55 ASP H H 1 0.648296422 0.212776741 . . . . . . . . . . 53263 1 44 . 1 1 56 56 ARG N N 15 . 1 1 56 56 ARG H H 1 0.796121539 0.281913812 . . . . . . . . . . 53263 1 45 . 1 1 57 57 ILE N N 15 . 1 1 57 57 ILE H H 1 0.851833499 0.277660540 . . . . . . . . . . 53263 1 46 . 1 1 59 59 GLU N N 15 . 1 1 59 59 GLU H H 1 0.445357107 0.219903302 . . . . . . . . . . 53263 1 47 . 1 1 60 60 LEU N N 15 . 1 1 60 60 LEU H H 1 0.795026882 0.304308031 . . . . . . . . . . 53263 1 48 . 1 1 61 61 LEU N N 15 . 1 1 61 61 LEU H H 1 1.009348442 0.430105402 . . . . . . . . . . 53263 1 49 . 1 1 62 62 SER N N 15 . 1 1 62 62 SER H H 1 0.377244056 0.101586474 . . . . . . . . . . 53263 1 50 . 1 1 63 63 GLU N N 15 . 1 1 63 63 GLU H H 1 0.170840407 0.037899524 . . . . . . . . . . 53263 1 51 . 1 1 64 64 ARG N N 15 . 1 1 64 64 ARG H H 1 -1.396705751 0.100902465 . . . . . . . . . . 53263 1 52 . 1 1 65 65 GLU N N 15 . 1 1 65 65 GLU H H 1 -0.122978080 0.021597809 . . . . . . . . . . 53263 1 53 . 1 1 66 66 SER N N 15 . 1 1 66 66 SER H H 1 -0.630750605 0.014962637 . . . . . . . . . . 53263 1 stop_ save_ ######################################## # Heteronuclear T1 relaxation values # ######################################## save_heteronucl_T1_relaxation_1 _Heteronucl_T1_list.Sf_category heteronucl_T1_relaxation _Heteronucl_T1_list.Sf_framecode heteronucl_T1_relaxation_1 _Heteronucl_T1_list.Entry_ID 53263 _Heteronucl_T1_list.ID 1 _Heteronucl_T1_list.Name DNA_CTD_ParB_T1 _Heteronucl_T1_list.Sample_condition_list_ID 1 _Heteronucl_T1_list.Sample_condition_list_label $sample_conditions_1 _Heteronucl_T1_list.Spectrometer_frequency_1H 500 _Heteronucl_T1_list.T1_coherence_type Sz _Heteronucl_T1_list.T1_val_units s _Heteronucl_T1_list.Details . _Heteronucl_T1_list.Text_data_format . _Heteronucl_T1_list.Text_data . loop_ _Heteronucl_T1_experiment.Experiment_ID _Heteronucl_T1_experiment.Experiment_name _Heteronucl_T1_experiment.Sample_ID _Heteronucl_T1_experiment.Sample_label _Heteronucl_T1_experiment.Sample_state _Heteronucl_T1_experiment.Entry_ID _Heteronucl_T1_experiment.Heteronucl_T1_list_ID 1 'T1/R1 relaxation' . . . 53263 1 stop_ loop_ _Heteronucl_T1_software.Software_ID _Heteronucl_T1_software.Software_label _Heteronucl_T1_software.Method_ID _Heteronucl_T1_software.Method_label _Heteronucl_T1_software.Entry_ID _Heteronucl_T1_software.Heteronucl_T1_list_ID 2 $software_2 . . 53263 1 stop_ loop_ _T1.ID _T1.Assembly_atom_ID _T1.Entity_assembly_ID _T1.Entity_ID _T1.Comp_index_ID _T1.Seq_ID _T1.Comp_ID _T1.Atom_ID _T1.Atom_type _T1.Atom_isotope_number _T1.Val _T1.Val_err _T1.Resonance_ID _T1.Auth_entity_assembly_ID _T1.Auth_seq_ID _T1.Auth_comp_ID _T1.Auth_atom_ID _T1.Entry_ID _T1.Heteronucl_T1_list_ID 1 . 1 1 5 5 ARG N N 15 0.6129 0.0282 . . . . . 53263 1 2 . 1 1 6 6 GLU N N 15 0.6206 0.0271 . . . . . 53263 1 3 . 1 1 7 7 THR N N 15 0.6391 0.0519 . . . . . 53263 1 4 . 1 1 8 8 LYS N N 15 0.6227 0.0315 . . . . . 53263 1 5 . 1 1 9 9 LYS N N 15 0.6105 0.0208 . . . . . 53263 1 6 . 1 1 10 10 LYS N N 15 0.6006 0.018 . . . . . 53263 1 7 . 1 1 11 11 GLU N N 15 0.6568 0.0139 . . . . . 53263 1 8 . 1 1 13 13 VAL N N 15 0.6964 0.0117 . . . . . 53263 1 9 . 1 1 14 14 LYS N N 15 0.6862 0.027 . . . . . 53263 1 10 . 1 1 15 15 ASP N N 15 0.7068 0.0731 . . . . . 53263 1 11 . 1 1 16 16 ALA N N 15 0.8292 0.0447 . . . . . 53263 1 12 . 1 1 17 17 VAL N N 15 0.8883 0.0692 . . . . . 53263 1 13 . 1 1 18 18 LEU N N 15 0.8901 0.0566 . . . . . 53263 1 14 . 1 1 19 19 LYS N N 15 0.9351 0.0451 . . . . . 53263 1 15 . 1 1 20 20 GLU N N 15 0.9097 0.0954 . . . . . 53263 1 16 . 1 1 21 21 ARG N N 15 0.9096 0.0983 . . . . . 53263 1 17 . 1 1 22 22 GLU N N 15 0.8315 0.0728 . . . . . 53263 1 18 . 1 1 23 23 SER N N 15 0.9884 0.0841 . . . . . 53263 1 19 . 1 1 24 24 TYR N N 15 1.0950 0.0984 . . . . . 53263 1 20 . 1 1 25 25 LEU N N 15 0.8609 0.163 . . . . . 53263 1 21 . 1 1 26 26 GLN N N 15 0.8781 0.0702 . . . . . 53263 1 22 . 1 1 27 27 ASN N N 15 0.8328 0.05 . . . . . 53263 1 23 . 1 1 29 29 PHE N N 15 1.039 0.0838 . . . . . 53263 1 24 . 1 1 30 30 GLY N N 15 1.2200 0.122 . . . . . 53263 1 25 . 1 1 31 31 THR N N 15 0.9733 0.0465 . . . . . 53263 1 26 . 1 1 32 32 THR N N 15 0.9922 0.0357 . . . . . 53263 1 27 . 1 1 33 33 VAL N N 15 0.9738 0.108 . . . . . 53263 1 28 . 1 1 34 34 ASN N N 15 0.9092 0.136 . . . . . 53263 1 29 . 1 1 35 35 ILE N N 15 1.0520 0.0785 . . . . . 53263 1 30 . 1 1 36 36 LYS N N 15 0.9233 0.0947 . . . . . 53263 1 31 . 1 1 37 37 ARG N N 15 1.0330 0.05 . . . . . 53263 1 32 . 1 1 38 38 GLN N N 15 0.7680 0.0456 . . . . . 53263 1 33 . 1 1 39 39 LYS N N 15 0.6411 0.0351 . . . . . 53263 1 34 . 1 1 40 40 LYS N N 15 0.7521 0.0358 . . . . . 53263 1 35 . 1 1 41 41 LYS N N 15 0.8394 0.0368 . . . . . 53263 1 36 . 1 1 42 42 GLY N N 15 0.9839 0.0581 . . . . . 53263 1 37 . 1 1 43 43 LYS N N 15 0.8807 0.629 . . . . . 53263 1 38 . 1 1 44 44 ILE N N 15 0.9584 0.0989 . . . . . 53263 1 39 . 1 1 45 45 GLU N N 15 0.9231 0.106 . . . . . 53263 1 40 . 1 1 46 46 ILE N N 15 0.6807 0.0982 . . . . . 53263 1 41 . 1 1 47 47 GLU N N 15 0.8527 0.106 . . . . . 53263 1 42 . 1 1 48 48 PHE N N 15 0.9104 0.0797 . . . . . 53263 1 43 . 1 1 49 49 PHE N N 15 0.9553 0.189 . . . . . 53263 1 44 . 1 1 50 50 SER N N 15 0.9154 0.0808 . . . . . 53263 1 45 . 1 1 52 52 GLU N N 15 0.9683 0.093 . . . . . 53263 1 46 . 1 1 54 54 LEU N N 15 0.9235 0.116 . . . . . 53263 1 47 . 1 1 55 55 ASP N N 15 0.9719 0.105 . . . . . 53263 1 48 . 1 1 56 56 ARG N N 15 0.9199 0.0921 . . . . . 53263 1 49 . 1 1 57 57 ILE N N 15 0.9428 0.126 . . . . . 53263 1 50 . 1 1 58 58 LEU N N 15 0.6719 0.116 . . . . . 53263 1 51 . 1 1 59 59 GLU N N 15 1.4 0.148 . . . . . 53263 1 52 . 1 1 60 60 LEU N N 15 0.8603 0.0485 . . . . . 53263 1 53 . 1 1 61 61 LEU N N 15 0.9321 0.0848 . . . . . 53263 1 54 . 1 1 62 62 SER N N 15 0.7811 0.0291 . . . . . 53263 1 55 . 1 1 63 63 GLU N N 15 0.6508 0.0188 . . . . . 53263 1 56 . 1 1 64 64 ARG N N 15 0.7729 0.0209 . . . . . 53263 1 57 . 1 1 65 65 GLU N N 15 0.6278 0.0118 . . . . . 53263 1 58 . 1 1 66 66 SER N N 15 0.8948 0.0101 . . . . . 53263 1 stop_ save_ ######################################## # Heteronuclear T2 relaxation values # ######################################## save_heteronucl_T2_relaxation_1 _Heteronucl_T2_list.Sf_category heteronucl_T2_relaxation _Heteronucl_T2_list.Sf_framecode heteronucl_T2_relaxation_1 _Heteronucl_T2_list.Entry_ID 53263 _Heteronucl_T2_list.ID 1 _Heteronucl_T2_list.Name CTD_ParB_DNA_T2 _Heteronucl_T2_list.Sample_condition_list_ID 1 _Heteronucl_T2_list.Sample_condition_list_label $sample_conditions_1 _Heteronucl_T2_list.Temp_calibration_method 'no calibration applied' _Heteronucl_T2_list.Temp_control_method 'no temperature control applied' _Heteronucl_T2_list.Spectrometer_frequency_1H 500 _Heteronucl_T2_list.T2_coherence_type S(+,-) _Heteronucl_T2_list.T2_val_units s _Heteronucl_T2_list.Rex_units . _Heteronucl_T2_list.Details . _Heteronucl_T2_list.Text_data_format . _Heteronucl_T2_list.Text_data . loop_ _Heteronucl_T2_experiment.Experiment_ID _Heteronucl_T2_experiment.Experiment_name _Heteronucl_T2_experiment.Sample_ID _Heteronucl_T2_experiment.Sample_label _Heteronucl_T2_experiment.Sample_state _Heteronucl_T2_experiment.Entry_ID _Heteronucl_T2_experiment.Heteronucl_T2_list_ID 2 'T2/R2 relaxation' . . . 53263 1 stop_ loop_ _Heteronucl_T2_software.Software_ID _Heteronucl_T2_software.Software_label _Heteronucl_T2_software.Method_ID _Heteronucl_T2_software.Method_label _Heteronucl_T2_software.Entry_ID _Heteronucl_T2_software.Heteronucl_T2_list_ID 2 $software_2 . . 53263 1 stop_ loop_ _T2.ID _T2.Assembly_atom_ID _T2.Entity_assembly_ID _T2.Entity_ID _T2.Comp_index_ID _T2.Seq_ID _T2.Comp_ID _T2.Atom_ID _T2.Atom_type _T2.Atom_isotope_number _T2.T2_val _T2.T2_val_err _T2.Rex_val _T2.Rex_err _T2.Resonance_ID _T2.Auth_entity_assembly_ID _T2.Auth_seq_ID _T2.Auth_comp_ID _T2.Auth_atom_ID _T2.Entry_ID _T2.Heteronucl_T2_list_ID 1 . 1 1 5 5 ARG N N 15 0.1794 0.0184 . . . . . . . 53263 1 2 . 1 1 6 6 GLU N N 15 0.1982 0.023 . . . . . . . 53263 1 3 . 1 1 7 7 THR N N 15 0.1693 0.0258 . . . . . . . 53263 1 4 . 1 1 8 8 LYS N N 15 0.1761 0.0241 . . . . . . . 53263 1 5 . 1 1 9 9 LYS N N 15 0.1843 0.0149 . . . . . . . 53263 1 6 . 1 1 10 10 LYS N N 15 0.1813 0.0159 . . . . . . . 53263 1 7 . 1 1 11 11 GLU N N 15 0.1651 0.0078 . . . . . . . 53263 1 8 . 1 1 13 13 VAL N N 15 0.1542 0.00463 . . . . . . . 53263 1 9 . 1 1 14 14 LYS N N 15 0.1155 0.00552 . . . . . . . 53263 1 10 . 1 1 15 15 ASP N N 15 0.1724 0.0595 . . . . . . . 53263 1 11 . 1 1 16 16 ALA N N 15 0.06247 0.003 . . . . . . . 53263 1 12 . 1 1 17 17 VAL N N 15 0.05838 0.00116 . . . . . . . 53263 1 13 . 1 1 18 18 LEU N N 15 0.05548 0.00128 . . . . . . . 53263 1 14 . 1 1 19 19 LYS N N 15 0.04915 0.000826 . . . . . . . 53263 1 15 . 1 1 20 20 GLU N N 15 0.05518 0.00139 . . . . . . . 53263 1 16 . 1 1 21 21 ARG N N 15 0.04677 0.00226 . . . . . . . 53263 1 17 . 1 1 22 22 GLU N N 15 0.04802 0.000458 . . . . . . . 53263 1 18 . 1 1 23 23 SER N N 15 0.04773 0.00127 . . . . . . . 53263 1 19 . 1 1 24 24 TYR N N 15 0.04641 0.00142 . . . . . . . 53263 1 20 . 1 1 25 25 LEU N N 15 0.04512 0.0027 . . . . . . . 53263 1 21 . 1 1 26 26 GLN N N 15 0.04847 0.00208 . . . . . . . 53263 1 22 . 1 1 27 27 ASN N N 15 0.05151 0.00122 . . . . . . . 53263 1 23 . 1 1 29 29 PHE N N 15 0.05832 0.00348 . . . . . . . 53263 1 24 . 1 1 30 30 GLY N N 15 0.05098 0.00293 . . . . . . . 53263 1 25 . 1 1 31 31 THR N N 15 0.04984 0.00122 . . . . . . . 53263 1 26 . 1 1 32 32 THR N N 15 0.05155 0.00172 . . . . . . . 53263 1 27 . 1 1 33 33 VAL N N 15 0.05739 0.00329 . . . . . . . 53263 1 28 . 1 1 34 34 ASN N N 15 0.05534 0.00317 . . . . . . . 53263 1 29 . 1 1 35 35 ILE N N 15 0.06344 0.00176 . . . . . . . 53263 1 30 . 1 1 36 36 LYS N N 15 0.05585 0.00127 . . . . . . . 53263 1 31 . 1 1 37 37 ARG N N 15 0.05903 0.00148 . . . . . . . 53263 1 32 . 1 1 38 38 GLN N N 15 0.0589 0.00271 . . . . . . . 53263 1 33 . 1 1 39 39 LYS N N 15 0.07518 0.00254 . . . . . . . 53263 1 34 . 1 1 40 40 LYS N N 15 0.05932 0.00193 . . . . . . . 53263 1 35 . 1 1 41 41 LYS N N 15 0.06727 0.00198 . . . . . . . 53263 1 36 . 1 1 42 42 GLY N N 15 0.05628 0.00121 . . . . . . . 53263 1 37 . 1 1 44 44 ILE N N 15 0.05754 0.00359 . . . . . . . 53263 1 38 . 1 1 45 45 GLU N N 15 0.05269 0.00169 . . . . . . . 53263 1 39 . 1 1 46 46 ILE N N 15 0.05934 0.00278 . . . . . . . 53263 1 40 . 1 1 47 47 GLU N N 15 0.05348 0.0031 . . . . . . . 53263 1 41 . 1 1 48 48 PHE N N 15 0.04923 0.0023 . . . . . . . 53263 1 42 . 1 1 49 49 PHE N N 15 0.05351 0.00295 . . . . . . . 53263 1 43 . 1 1 50 50 SER N N 15 0.06536 0.00326 . . . . . . . 53263 1 44 . 1 1 52 52 GLU N N 15 0.05006 0.0022 . . . . . . . 53263 1 45 . 1 1 54 54 LEU N N 15 0.04874 0.00327 . . . . . . . 53263 1 46 . 1 1 55 55 ASP N N 15 0.0486 0.00381 . . . . . . . 53263 1 47 . 1 1 56 56 ARG N N 15 0.0522 0.00238 . . . . . . . 53263 1 48 . 1 1 59 59 GLU N N 15 0.04698 0.00161 . . . . . . . 53263 1 49 . 1 1 60 60 LEU N N 15 0.06233 0.00361 . . . . . . . 53263 1 50 . 1 1 61 61 LEU N N 15 0.05225 0.00201 . . . . . . . 53263 1 51 . 1 1 62 62 SER N N 15 0.06897 0.00273 . . . . . . . 53263 1 52 . 1 1 63 63 GLU N N 15 0.1109 0.00263 . . . . . . . 53263 1 53 . 1 1 64 64 ARG N N 15 0.1128 0.00567 . . . . . . . 53263 1 54 . 1 1 65 65 GLU N N 15 0.1798 0.00801 . . . . . . . 53263 1 55 . 1 1 66 66 SER N N 15 0.4299 0.0182 . . . . . . . 53263 1 stop_ save_