data_52052 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 52052 _Entry.Title ; Residual dipolar couplings measured on HIV-1 TAR ES1 mutant C30U using Pf1 phage alignment media for validating FARFAR-NMR ensemble ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2023-07-22 _Entry.Accession_date 2023-07-22 _Entry.Last_release_date 2023-07-24 _Entry.Original_release_date 2023-07-24 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID 1 _Entry.Generated_software_label $software_1 _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Rohit Roy . . . 0000-0001-8569-3245 52052 2 Ainan Geng . . . . 52052 3 Honglue Shi . . . . 52052 4 Dawn Merriman . K. . . 52052 5 Elizabeth Dethoff . A. . . 52052 6 Loic Salmon . . . . 52052 7 Hashim Al-Hashimi . M. . . 52052 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID RDCs 1 52052 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID 'residual dipolar couplings' 16 52052 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 3 . . 2023-10-31 2022-07-22 update BMRB 'update entry citation' 52052 2 . . 2023-10-16 2022-07-22 update author 'update entry citation' 52052 1 . . 2023-07-26 2022-07-22 original author 'original release' 52052 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 52053 'Residual dipolar couplings measured on HIV-1 TAR ES1 mutant A35G' 52052 PDB 8THV 'FARFAR-NMR ensemble that was validated using submitted RDCs' 52052 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 52052 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 37831584 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Kinetic Resolution of the Atomic 3D Structures Formed by Ground and Excited Conformational States in an RNA Dynamic Ensemble ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'J. Am. Chem. Soc.' _Citation.Journal_name_full 'Journal of the American Chemical Society' _Citation.Journal_volume 145 _Citation.Journal_issue 42 _Citation.Journal_ASTM JACSAT _Citation.Journal_ISSN 1520-5126 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 22964 _Citation.Page_last 22978 _Citation.Year 2023 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Rohit Roy . . . . 52052 1 2 Ainan Geng . . . . 52052 1 3 Honglue Shi . . . . 52052 1 4 Dawn Merriman . K. . . 52052 1 5 Elizabeth Dethoff . A. . . 52052 1 6 Loic Salmon . . . . 52052 1 7 Hashim Al-Hashimi . M. . . 52052 1 stop_ loop_ _Citation_keyword.Keyword _Citation_keyword.Entry_ID _Citation_keyword.Citation_ID 'HIV-1 TAR, viral RNA, Phage alignment, Excited State' 52052 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 52052 _Assembly.ID 1 _Assembly.Name 'Monomeric RNA' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 C30U_monomer 1 $entity_1 . . yes native no no . . . 52052 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 52052 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGCGAGCUUGGGAGCUCGCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq 1,2,3,26,27,28,29,30,31,32,33,34,35,36,37,38,39,4,5,6 _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 20 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_biological_function.Biological_function _Entity_biological_function.Entry_ID _Entity_biological_function.Entity_ID 'Mutant that traps HIV-1 TAR apical loop in the alternative excited conformational state ES1' 52052 1 stop_ loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 G . 52052 1 2 2 G . 52052 1 3 3 C . 52052 1 4 26 G . 52052 1 5 27 A . 52052 1 6 28 G . 52052 1 7 29 C . 52052 1 8 30 U . 52052 1 9 31 U . 52052 1 10 32 G . 52052 1 11 33 G . 52052 1 12 34 G . 52052 1 13 35 A . 52052 1 14 36 G . 52052 1 15 37 C . 52052 1 16 38 U . 52052 1 17 39 C . 52052 1 18 4 G . 52052 1 19 5 C . 52052 1 20 6 C . 52052 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 52052 1 . G 2 2 52052 1 . C 3 3 52052 1 . G 4 4 52052 1 . A 5 5 52052 1 . G 6 6 52052 1 . C 7 7 52052 1 . U 8 8 52052 1 . U 9 9 52052 1 . G 10 10 52052 1 . G 11 11 52052 1 . G 12 12 52052 1 . A 13 13 52052 1 . G 14 14 52052 1 . C 15 15 52052 1 . U 16 16 52052 1 . C 17 17 52052 1 . G 18 18 52052 1 . C 19 19 52052 1 . C 20 20 52052 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 52052 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 11676 organism . HIV-1 HIV-1 . . Viruses . Lentivirus HIV-1 . . . . . . . . . . . . . 52052 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 52052 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 52052 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 52052 _Sample.ID 1 _Sample.Name C30U-EII3-TAR _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'C30U HIV-1 TAR RNA EII3 mutant' 'natural abundance' . . 1 $entity_1 . . 2 . . mM . . . . 52052 1 2 D2O 'natural abundance' . . . . . . 10 . . % . . . . 52052 1 3 'sodium phosphate' 'natural abundance' . . . . . . 15 . . mM . . . . 52052 1 4 'sodium chloride' 'natural abundance' . . . . . . 25 . . mM . . . . 52052 1 5 EDTA 'natural abundance' . . . . . . 0.1 . . mM . . . . 52052 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 52052 _Sample_condition_list.ID 1 _Sample_condition_list.Name Standard _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID pH 6.4 . pH 52052 1 pressure 1 . atm 52052 1 temperature 298 . K 52052 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 52052 _Software.ID 1 _Software.Type . _Software.Name NMRPipe _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'data analysis' . 52052 1 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 52052 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name Bruker800US2 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE III' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 52052 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 13C-1H S3CT HSQC' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 52052 1 2 '2D 13C-1H TROSY HSQC' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 52052 1 3 '2D 13C-1H S3CT HSQC' no . . . . . . . . . . . . 1 $sample_1 anisotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 52052 1 4 '2D 13C-1H TROSY HSQC' no . . . . . . . . . . . . 1 $sample_1 anisotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 52052 1 stop_ save_ ################################ # Residual dipolar couplings # ################################ save_RDCs_1 _RDC_list.Sf_category RDCs _RDC_list.Sf_framecode RDCs_1 _RDC_list.Entry_ID 52052 _RDC_list.ID 1 _RDC_list.Name 'C30U-EII3-TAR RDCs' _RDC_list.Sample_condition_list_ID 1 _RDC_list.Sample_condition_list_label $sample_conditions_1 _RDC_list.Spectrometer_frequency_1H 800 _RDC_list.Bond_length_usage_flag . _RDC_list.Dipolar_constraint_calib_method . _RDC_list.Mol_align_tensor_axial_sym_mol . _RDC_list.Mol_align_tensor_rhombic_mol . _RDC_list.General_order_param_int_motions . _RDC_list.Assumed_H_N_bond_length . _RDC_list.Assumed_H_C_bond_length . _RDC_list.Assumed_C_N_bond_length . _RDC_list.Details 'Aligned using 25 mg/ml Pf1 phage media' _RDC_list.Text_data_format . _RDC_list.Text_data . loop_ _RDC_experiment.Experiment_ID _RDC_experiment.Experiment_name _RDC_experiment.Sample_ID _RDC_experiment.Sample_label _RDC_experiment.Sample_state _RDC_experiment.Entry_ID _RDC_experiment.RDC_list_ID 3 '2D 13C-1H S3CT HSQC' . . . 52052 1 4 '2D 13C-1H TROSY HSQC' . . . 52052 1 stop_ loop_ _RDC_software.Software_ID _RDC_software.Software_label _RDC_software.Method_ID _RDC_software.Method_label _RDC_software.Entry_ID _RDC_software.RDC_list_ID 1 $software_1 . . 52052 1 stop_ loop_ _RDC.ID _RDC.RDC_code _RDC.Assembly_atom_ID_1 _RDC.Entity_assembly_ID_1 _RDC.Entity_ID_1 _RDC.Comp_index_ID_1 _RDC.Seq_ID_1 _RDC.Comp_ID_1 _RDC.Atom_ID_1 _RDC.Atom_type_1 _RDC.Atom_isotope_number_1 _RDC.Ambiguity_code_1 _RDC.Assembly_atom_ID_2 _RDC.Entity_assembly_ID_2 _RDC.Entity_ID_2 _RDC.Comp_index_ID_2 _RDC.Seq_ID_2 _RDC.Comp_ID_2 _RDC.Atom_ID_2 _RDC.Atom_type_2 _RDC.Atom_isotope_number_2 _RDC.Ambiguity_code_2 _RDC.Val _RDC.Val_min _RDC.Val_max _RDC.Val_err _RDC.Val_bond_length _RDC.Resonance_ID_1 _RDC.Resonance_ID_2 _RDC.Auth_entity_assembly_ID_1 _RDC.Auth_seq_ID_1 _RDC.Auth_comp_ID_1 _RDC.Auth_atom_ID_1 _RDC.Auth_entity_assembly_ID_2 _RDC.Auth_seq_ID_2 _RDC.Auth_comp_ID_2 _RDC.Auth_atom_ID_2 _RDC.Entry_ID _RDC.RDC_list_ID 1 DCH . 1 1 5 5 A C8 C 13 . . 1 1 5 5 A H8 H 1 . 14.100 . . 2.000 . . . . 27 A C8 . 27 A H8 52052 1 2 DCH . 1 1 5 5 A C2 C 13 . . 1 1 5 5 A H2 H 1 . 12.700 . . 2.000 . . . . 27 A C2 . 27 A H2 52052 1 3 DCH . 1 1 5 5 A C1' C 13 . . 1 1 5 5 A H1' H 1 . -13.600 . . 2.000 . . . . 27 A C1' . 27 A H1' 52052 1 4 DCH . 1 1 7 7 C C1' C 13 . . 1 1 7 7 C H1' H 1 . -4.200 . . 2.000 . . . . 29 C C1' . 29 C H1' 52052 1 5 DCH . 1 1 9 9 U C6 C 13 . . 1 1 9 9 U H6 H 1 . 5.100 . . 2.000 . . . . 31 U C6 . 31 U H6 52052 1 6 DCH . 1 1 10 10 G C8 C 13 . . 1 1 10 10 G H8 H 1 . 3.800 . . 2.000 . . . . 32 G C8 . 32 G H8 52052 1 7 DCH . 1 1 10 10 G C1' C 13 . . 1 1 10 10 G H1' H 1 . 0.300 . . 2.000 . . . . 32 G C1' . 32 G H1' 52052 1 8 DCH . 1 1 11 11 G C8 C 13 . . 1 1 11 11 G H8 H 1 . 3.600 . . 2.000 . . . . 33 G C8 . 33 G H8 52052 1 9 DCH . 1 1 11 11 G C1' C 13 . . 1 1 11 11 G H1' H 1 . -0.200 . . 2.000 . . . . 33 G C1' . 33 G H1' 52052 1 10 DCH . 1 1 12 12 G C8 C 13 . . 1 1 12 12 G H8 H 1 . 5.500 . . 2.000 . . . . 34 G C8 . 34 G H8 52052 1 11 DCH . 1 1 13 13 A C8 C 13 . . 1 1 13 13 A H8 H 1 . 11.100 . . 2.000 . . . . 35 A C8 . 35 A H8 52052 1 12 DCH . 1 1 13 13 A C2 C 13 . . 1 1 13 13 A H2 H 1 . 12.000 . . 2.000 . . . . 35 A C2 . 35 A H2 52052 1 13 DCH . 1 1 13 13 A C1' C 13 . . 1 1 13 13 A H1' H 1 . -2.700 . . 2.000 . . . . 35 A C1' . 35 A H1' 52052 1 14 DCH . 1 1 14 14 G C8 C 13 . . 1 1 14 14 G H8 H 1 . 9.500 . . 2.000 . . . . 36 G C8 . 36 G H8 52052 1 15 DCH . 1 1 15 15 C C6 C 13 . . 1 1 15 15 C H6 H 1 . 11.200 . . 2.000 . . . . 37 C C6 . 37 C H6 52052 1 16 DCH . 1 1 16 16 U C6 C 13 . . 1 1 16 16 U H6 H 1 . 14.400 . . 2.000 . . . . 38 U C6 . 38 U H6 52052 1 stop_ save_