data_36375 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 36375 _Entry.Title ; Quadruplex-duplex hybrid structure in the PIM1 gene, Form 2 ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2020-08-25 _Entry.Accession_date 2021-01-29 _Entry.Last_release_date 2021-01-29 _Entry.Original_release_date 2021-01-29 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.2.0.16 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 F. Winnerdy F. R. . . 36375 2 D. Tan D. T.J. . . 36375 3 K. Lim K. W. . . 36375 4 A. Phan A. T. . . 36375 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID DNA . 36375 G-quadruplex . 36375 PIM1 . 36375 'Quadruplex-duplex hybrid' . 36375 duplex . 36375 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 36375 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 186 36375 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2025-10-24 . original BMRB . 36375 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 36374 'Quadruplex-duplex hybrid structure in the PIM1 gene, Form 1' 36375 PDB 7CV4 'BMRB Entry Tracking System' 36375 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 36375 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 32976598 _Citation.DOI 10.1093/nar/gkaa752 _Citation.Full_citation . _Citation.Title ; Coexistence of two quadruplex-duplex hybrids in the PIM1 gene. ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full 'Nucleic acids research' _Citation.Journal_volume 48 _Citation.Journal_issue 19 _Citation.Journal_ASTM NARHAD _Citation.Journal_ISSN 0305-1048 _Citation.Journal_CSD 0389 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 11162 _Citation.Page_last 11171 _Citation.Year 2020 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Derrick Tan D. J.Y. . . 36375 1 2 Fernaldo Winnerdy F. R. . . 36375 1 3 'Kah Wai' Lim K. W. . . 36375 1 4 'Anh Tuan' Phan A. T. . . 36375 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 36375 _Assembly.ID 1 _Assembly.Name 'PIM1 gene, Form 2' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state 'not present' _Assembly.Molecular_mass 8177.216 _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 entity_1 1 $entity_1 A A yes . . . . . . 36375 1 stop_ loop_ _Chem_comp_assembly.Assembly_chem_comp_ID _Chem_comp_assembly.Entity_assembly_ID _Chem_comp_assembly.Entity_ID _Chem_comp_assembly.Comp_index_ID _Chem_comp_assembly.Comp_ID _Chem_comp_assembly.Seq_ID _Chem_comp_assembly.Auth_entity_assembly_ID _Chem_comp_assembly.Auth_asym_ID _Chem_comp_assembly.Auth_seq_ID _Chem_comp_assembly.Auth_comp_ID _Chem_comp_assembly.Auth_variant_ID _Chem_comp_assembly.Sequence_linking _Chem_comp_assembly.Cis_residue _Chem_comp_assembly.NEF_index _Chem_comp_assembly.Entry_ID _Chem_comp_assembly.Assembly_ID . 1 1 1 DG 1 . A 1 DG . start . . 36375 1 . 1 1 10 DC 10 . A 10 DC . middle . . 36375 1 . 1 1 11 DG 11 . A 11 DG . middle . . 36375 1 . 1 1 12 DC 12 . A 12 DC . middle . . 36375 1 . 1 1 13 DC 13 . A 13 DC . middle . . 36375 1 . 1 1 14 DA 14 . A 14 DA . middle . . 36375 1 . 1 1 15 DG 15 . A 15 DG . middle . . 36375 1 . 1 1 16 DC 16 . A 16 DC . middle . . 36375 1 . 1 1 17 DG 17 . A 17 DG . middle . . 36375 1 . 1 1 18 DG 18 . A 18 DG . middle . . 36375 1 . 1 1 19 DG 19 . A 19 DG . middle . . 36375 1 . 1 1 2 DG 2 . A 2 DG . middle . . 36375 1 . 1 1 20 DG 20 . A 20 DG . middle . . 36375 1 . 1 1 21 DT 21 . A 21 DT . middle . . 36375 1 . 1 1 22 DC 22 . A 22 DC . middle . . 36375 1 . 1 1 23 DG 23 . A 23 DG . middle . . 36375 1 . 1 1 24 DG 24 . A 24 DG . middle . . 36375 1 . 1 1 25 DG 25 . A 25 DG . middle . . 36375 1 . 1 1 26 DC 26 . A 26 DC . end . . 36375 1 . 1 1 3 DG 3 . A 3 DG . middle . . 36375 1 . 1 1 4 DA 4 . A 4 DA . middle . . 36375 1 . 1 1 5 DG 5 . A 5 DG . middle . . 36375 1 . 1 1 6 DG 6 . A 6 DG . middle . . 36375 1 . 1 1 7 DG 7 . A 7 DG . middle . . 36375 1 . 1 1 8 DC 8 . A 8 DC . middle . . 36375 1 . 1 1 9 DG 9 . A 9 DG . middle . . 36375 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 36375 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name 'DNA (26-MER)' _Entity.Type polymer _Entity.Polymer_common_type DNA _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGGAGGGCGCGCCAGCGGGG TCGGGC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 26 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 8177.216 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 DG . 36375 1 2 2 DG . 36375 1 3 3 DG . 36375 1 4 4 DA . 36375 1 5 5 DG . 36375 1 6 6 DG . 36375 1 7 7 DG . 36375 1 8 8 DC . 36375 1 9 9 DG . 36375 1 10 10 DC . 36375 1 11 11 DG . 36375 1 12 12 DC . 36375 1 13 13 DC . 36375 1 14 14 DA . 36375 1 15 15 DG . 36375 1 16 16 DC . 36375 1 17 17 DG . 36375 1 18 18 DG . 36375 1 19 19 DG . 36375 1 20 20 DG . 36375 1 21 21 DT . 36375 1 22 22 DC . 36375 1 23 23 DG . 36375 1 24 24 DG . 36375 1 25 25 DG . 36375 1 26 26 DC . 36375 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DG 1 1 36375 1 . DG 2 2 36375 1 . DG 3 3 36375 1 . DA 4 4 36375 1 . DG 5 5 36375 1 . DG 6 6 36375 1 . DG 7 7 36375 1 . DC 8 8 36375 1 . DG 9 9 36375 1 . DC 10 10 36375 1 . DG 11 11 36375 1 . DC 12 12 36375 1 . DC 13 13 36375 1 . DA 14 14 36375 1 . DG 15 15 36375 1 . DC 16 16 36375 1 . DG 17 17 36375 1 . DG 18 18 36375 1 . DG 19 19 36375 1 . DG 20 20 36375 1 . DT 21 21 36375 1 . DC 22 22 36375 1 . DG 23 23 36375 1 . DG 24 24 36375 1 . DG 25 25 36375 1 . DC 26 26 36375 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 36375 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 'no natural source' . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 36375 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 36375 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' unidentified . . . . . . . . . . . . . . . 36375 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_H2O _Sample.Sf_category sample _Sample.Sf_framecode sample_H2O _Sample.Entry_ID 36375 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '2 mM PIM1-C, 70 mM KCl, 20 mM potassium phosphate, 50 uM DSS, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'DNA (26-MER)' 'natural abundance' 1 $assembly 1 $entity_1 . DNA . . . mM . . . . 36375 1 2 KCl 'natural abundance' . . . . . salt 70 . . mM . . . . 36375 1 3 'potassium phosphate' 'natural abundance' . . . . . buffer 20 . . mM . . . . 36375 1 4 DSS 'natural abundance' . . . . . 'internal reference' 50 . . uM . . . . 36375 1 5 H2O 'natural abundance' . . . . . solvent 90 . . % . . . . 36375 1 6 D2O [U-2H] . . . . . solvent 10 . . % . . . . 36375 1 stop_ save_ save_sample_D2O _Sample.Sf_category sample _Sample.Sf_framecode sample_D2O _Sample.Entry_ID 36375 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '2 mM PIM1-C, 70 mM KCl, 20 mM potassium phosphate, 50 uM DSS, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'DNA (26-MER)' 'natural abundance' 1 $assembly 1 $entity_1 . DNA . . . mM . . . . 36375 2 2 KCl 'natural abundance' . . . . . salt 70 . . mM . . . . 36375 2 3 'potassium phosphate' 'natural abundance' . . . . . buffer 20 . . mM . . . . 36375 2 4 DSS 'natural abundance' . . . . . 'internal reference' 50 . . uM . . . . 36375 2 5 D2O [U-2H] . . . . . solvent 100 . . % . . . . 36375 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 36375 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details condition1 loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 100 . mM 36375 1 pH 7 . pH 36375 1 pressure 1 . atm 36375 1 temperature 298 . K 36375 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 36375 _Software.ID 1 _Software.Type . _Software.Name TopSpin _Software.Version 2.1 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 36375 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID collection . 36375 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 36375 _Software.ID 2 _Software.Type . _Software.Name TopSpin _Software.Version 4.0 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 36375 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 36375 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 36375 _Software.ID 3 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Lee, Tonelli, Markley' . . 36375 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 36375 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 36375 _Software.ID 4 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Lee, Tonelli, Markley' . . 36375 4 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'peak picking' . 36375 4 stop_ save_ save_software_5 _Software.Sf_category software _Software.Sf_framecode software_5 _Software.Entry_ID 36375 _Software.ID 5 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 36375 5 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'structure calculation' . 36375 5 stop_ save_ save_software_6 _Software.Sf_category software _Software.Sf_framecode software_6 _Software.Entry_ID 36375 _Software.ID 6 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 36375 6 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 36375 6 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 36375 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE II' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list_1 _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list_1 _NMR_spectrometer_list.Entry_ID 36375 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker 'AVANCE II' . 600 . . . 36375 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 36375 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' . . . . . . . . . . . . . 1 $sample_H2O isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36375 1 2 '2D 1H-1H NOESY' . . . . . . . . . . . . . 2 $sample_D2O isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36375 1 3 '2D 1H-1H TOCSY' . . . . . . . . . . . . . 2 $sample_D2O isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36375 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 36375 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.000 internal direct 1.0 . . . . . 36375 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 36375 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' 1 $sample_H2O isotropic 36375 1 2 '2D 1H-1H NOESY' 2 $sample_D2O isotropic 36375 1 3 '2D 1H-1H TOCSY' 2 $sample_D2O isotropic 36375 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DG H1 H 1 13.735 0.001 . 1 . . . . A 1 DG H1 . 36375 1 2 . 1 . 1 1 1 DG H1' H 1 5.956 0.001 . 1 . . . . A 1 DG H1' . 36375 1 3 . 1 . 1 1 1 DG H2' H 1 2.572 0.002 . . . . . . A 1 DG H2' . 36375 1 4 . 1 . 1 1 1 DG H2'' H 1 3.088 0.002 . . . . . . A 1 DG H2'' . 36375 1 5 . 1 . 1 1 1 DG H3' H 1 4.880 0.001 . 1 . . . . A 1 DG H3' . 36375 1 6 . 1 . 1 1 1 DG H4' H 1 4.219 0.002 . 1 . . . . A 1 DG H4' . 36375 1 7 . 1 . 1 1 1 DG H8 H 1 7.420 0.002 . 1 . . . . A 1 DG H8 . 36375 1 8 . 1 . 1 2 2 DG H1 H 1 11.264 0.001 . 1 . . . . A 2 DG H1 . 36375 1 9 . 1 . 1 2 2 DG H1' H 1 5.841 0.001 . 1 . . . . A 2 DG H1' . 36375 1 10 . 1 . 1 2 2 DG H2' H 1 3.108 0.000 . . . . . . A 2 DG H2' . 36375 1 11 . 1 . 1 2 2 DG H2'' H 1 2.794 0.001 . . . . . . A 2 DG H2'' . 36375 1 12 . 1 . 1 2 2 DG H3' H 1 5.051 0.001 . 1 . . . . A 2 DG H3' . 36375 1 13 . 1 . 1 2 2 DG H4' H 1 4.354 0.001 . 1 . . . . A 2 DG H4' . 36375 1 14 . 1 . 1 2 2 DG H8 H 1 7.443 0.001 . 1 . . . . A 2 DG H8 . 36375 1 15 . 1 . 1 3 3 DG H1 H 1 11.817 0.001 . 1 . . . . A 3 DG H1 . 36375 1 16 . 1 . 1 3 3 DG H1' H 1 6.126 0.001 . 1 . . . . A 3 DG H1' . 36375 1 17 . 1 . 1 3 3 DG H2' H 1 2.935 0.001 . . . . . . A 3 DG H2' . 36375 1 18 . 1 . 1 3 3 DG H2'' H 1 2.586 0.001 . . . . . . A 3 DG H2'' . 36375 1 19 . 1 . 1 3 3 DG H3' H 1 5.115 0.003 . 1 . . . . A 3 DG H3' . 36375 1 20 . 1 . 1 3 3 DG H4' H 1 4.380 0.001 . 1 . . . . A 3 DG H4' . 36375 1 21 . 1 . 1 3 3 DG H8 H 1 7.606 0.001 . 1 . . . . A 3 DG H8 . 36375 1 22 . 1 . 1 4 4 DA H1' H 1 6.383 0.000 . 1 . . . . A 4 DA H1' . 36375 1 23 . 1 . 1 4 4 DA H2' H 1 2.773 0.001 . . . . . . A 4 DA H2' . 36375 1 24 . 1 . 1 4 4 DA H2'' H 1 2.570 0.002 . . . . . . A 4 DA H2'' . 36375 1 25 . 1 . 1 4 4 DA H3' H 1 5.136 0.001 . 1 . . . . A 4 DA H3' . 36375 1 26 . 1 . 1 4 4 DA H4' H 1 4.457 0.001 . 1 . . . . A 4 DA H4' . 36375 1 27 . 1 . 1 4 4 DA H8 H 1 8.287 0.000 . 1 . . . . A 4 DA H8 . 36375 1 28 . 1 . 1 5 5 DG H1' H 1 6.113 0.002 . 1 . . . . A 5 DG H1' . 36375 1 29 . 1 . 1 5 5 DG H2' H 1 2.554 0.001 . . . . . . A 5 DG H2' . 36375 1 30 . 1 . 1 5 5 DG H2'' H 1 2.793 0.001 . . . . . . A 5 DG H2'' . 36375 1 31 . 1 . 1 5 5 DG H3' H 1 5.069 0.001 . 1 . . . . A 5 DG H3' . 36375 1 32 . 1 . 1 5 5 DG H4' H 1 4.420 0.001 . 1 . . . . A 5 DG H4' . 36375 1 33 . 1 . 1 5 5 DG H8 H 1 7.372 0.003 . 1 . . . . A 5 DG H8 . 36375 1 34 . 1 . 1 6 6 DG H1 H 1 11.639 0.001 . 1 . . . . A 6 DG H1 . 36375 1 35 . 1 . 1 6 6 DG H1' H 1 6.096 0.001 . 1 . . . . A 6 DG H1' . 36375 1 36 . 1 . 1 6 6 DG H2' H 1 3.112 0.001 . . . . . . A 6 DG H2' . 36375 1 37 . 1 . 1 6 6 DG H2'' H 1 3.716 0.002 . . . . . . A 6 DG H2'' . 36375 1 38 . 1 . 1 6 6 DG H3' H 1 5.043 0.001 . 1 . . . . A 6 DG H3' . 36375 1 39 . 1 . 1 6 6 DG H4' H 1 4.471 0.001 . 1 . . . . A 6 DG H4' . 36375 1 40 . 1 . 1 6 6 DG H8 H 1 7.395 0.003 . 1 . . . . A 6 DG H8 . 36375 1 41 . 1 . 1 7 7 DG H1 H 1 11.552 0.000 . 1 . . . . A 7 DG H1 . 36375 1 42 . 1 . 1 7 7 DG H1' H 1 5.604 0.001 . 1 . . . . A 7 DG H1' . 36375 1 43 . 1 . 1 7 7 DG H2' H 1 2.631 0.001 . . . . . . A 7 DG H2' . 36375 1 44 . 1 . 1 7 7 DG H2'' H 1 2.456 0.001 . . . . . . A 7 DG H2'' . 36375 1 45 . 1 . 1 7 7 DG H3' H 1 5.017 0.002 . 1 . . . . A 7 DG H3' . 36375 1 46 . 1 . 1 7 7 DG H4' H 1 4.411 0.001 . 1 . . . . A 7 DG H4' . 36375 1 47 . 1 . 1 7 7 DG H8 H 1 8.010 0.001 . 1 . . . . A 7 DG H8 . 36375 1 48 . 1 . 1 8 8 DC H1' H 1 6.190 0.001 . 1 . . . . A 8 DC H1' . 36375 1 49 . 1 . 1 8 8 DC H2' H 1 1.831 0.002 . . . . . . A 8 DC H2' . 36375 1 50 . 1 . 1 8 8 DC H2'' H 1 2.553 0.002 . . . . . . A 8 DC H2'' . 36375 1 51 . 1 . 1 8 8 DC H3' H 1 5.024 0.001 . 1 . . . . A 8 DC H3' . 36375 1 52 . 1 . 1 8 8 DC H4' H 1 4.192 0.002 . 1 . . . . A 8 DC H4' . 36375 1 53 . 1 . 1 8 8 DC H5 H 1 5.568 0.002 . 1 . . . . A 8 DC H5 . 36375 1 54 . 1 . 1 8 8 DC H6 H 1 7.446 0.001 . 1 . . . . A 8 DC H6 . 36375 1 55 . 1 . 1 8 8 DC H41 H 1 6.613 0.001 . . . . . . A 8 DC H41 . 36375 1 56 . 1 . 1 8 8 DC H42 H 1 8.459 0.002 . . . . . . A 8 DC H42 . 36375 1 57 . 1 . 1 9 9 DG H1 H 1 12.914 0.001 . 1 . . . . A 9 DG H1 . 36375 1 58 . 1 . 1 9 9 DG H1' H 1 5.637 0.001 . 1 . . . . A 9 DG H1' . 36375 1 59 . 1 . 1 9 9 DG H2' H 1 2.575 0.002 . . . . . . A 9 DG H2' . 36375 1 60 . 1 . 1 9 9 DG H2'' H 1 2.575 0.002 . . . . . . A 9 DG H2'' . 36375 1 61 . 1 . 1 9 9 DG H3' H 1 4.973 0.001 . 1 . . . . A 9 DG H3' . 36375 1 62 . 1 . 1 9 9 DG H4' H 1 4.288 0.002 . 1 . . . . A 9 DG H4' . 36375 1 63 . 1 . 1 9 9 DG H8 H 1 7.953 0.000 . 1 . . . . A 9 DG H8 . 36375 1 64 . 1 . 1 10 10 DC H1' H 1 5.953 0.001 . 1 . . . . A 10 DC H1' . 36375 1 65 . 1 . 1 10 10 DC H2' H 1 1.636 0.002 . . . . . . A 10 DC H2' . 36375 1 66 . 1 . 1 10 10 DC H2'' H 1 2.303 0.002 . . . . . . A 10 DC H2'' . 36375 1 67 . 1 . 1 10 10 DC H3' H 1 4.762 0.001 . 1 . . . . A 10 DC H3' . 36375 1 68 . 1 . 1 10 10 DC H4' H 1 4.224 0.001 . 1 . . . . A 10 DC H4' . 36375 1 69 . 1 . 1 10 10 DC H5 H 1 5.148 0.003 . 1 . . . . A 10 DC H5 . 36375 1 70 . 1 . 1 10 10 DC H6 H 1 7.072 0.001 . 1 . . . . A 10 DC H6 . 36375 1 71 . 1 . 1 10 10 DC H41 H 1 6.728 0.001 . . . . . . A 10 DC H41 . 36375 1 72 . 1 . 1 10 10 DC H42 H 1 8.434 0.000 . . . . . . A 10 DC H42 . 36375 1 73 . 1 . 1 11 11 DG H1' H 1 5.666 0.001 . 1 . . . . A 11 DG H1' . 36375 1 74 . 1 . 1 11 11 DG H2' H 1 2.721 0.000 . . . . . . A 11 DG H2' . 36375 1 75 . 1 . 1 11 11 DG H2'' H 1 2.422 0.000 . . . . . . A 11 DG H2'' . 36375 1 76 . 1 . 1 11 11 DG H3' H 1 4.905 0.001 . 1 . . . . A 11 DG H3' . 36375 1 77 . 1 . 1 11 11 DG H4' H 1 4.440 0.001 . 1 . . . . A 11 DG H4' . 36375 1 78 . 1 . 1 11 11 DG H8 H 1 8.112 0.001 . 1 . . . . A 11 DG H8 . 36375 1 79 . 1 . 1 12 12 DC H1' H 1 5.615 0.000 . 1 . . . . A 12 DC H1' . 36375 1 80 . 1 . 1 12 12 DC H2' H 1 1.764 0.001 . . . . . . A 12 DC H2' . 36375 1 81 . 1 . 1 12 12 DC H2'' H 1 1.871 0.002 . . . . . . A 12 DC H2'' . 36375 1 82 . 1 . 1 12 12 DC H3' H 1 4.421 0.002 . 1 . . . . A 12 DC H3' . 36375 1 83 . 1 . 1 12 12 DC H4' H 1 3.179 0.001 . 1 . . . . A 12 DC H4' . 36375 1 84 . 1 . 1 12 12 DC H5 H 1 5.532 0.001 . 1 . . . . A 12 DC H5 . 36375 1 85 . 1 . 1 12 12 DC H6 H 1 7.410 0.001 . 1 . . . . A 12 DC H6 . 36375 1 86 . 1 . 1 13 13 DC H1' H 1 6.095 0.001 . 1 . . . . A 13 DC H1' . 36375 1 87 . 1 . 1 13 13 DC H2' H 1 2.087 0.001 . . . . . . A 13 DC H2' . 36375 1 88 . 1 . 1 13 13 DC H2'' H 1 2.420 0.002 . . . . . . A 13 DC H2'' . 36375 1 89 . 1 . 1 13 13 DC H3' H 1 4.547 0.001 . 1 . . . . A 13 DC H3' . 36375 1 90 . 1 . 1 13 13 DC H4' H 1 3.841 0.001 . 1 . . . . A 13 DC H4' . 36375 1 91 . 1 . 1 13 13 DC H5 H 1 5.806 0.001 . 1 . . . . A 13 DC H5 . 36375 1 92 . 1 . 1 13 13 DC H6 H 1 7.557 0.001 . 1 . . . . A 13 DC H6 . 36375 1 93 . 1 . 1 14 14 DA H1' H 1 6.072 0.001 . 1 . . . . A 14 DA H1' . 36375 1 94 . 1 . 1 14 14 DA H2 H 1 7.917 0.000 . 1 . . . . A 14 DA H2 . 36375 1 95 . 1 . 1 14 14 DA H2' H 1 2.347 0.001 . . . . . . A 14 DA H2' . 36375 1 96 . 1 . 1 14 14 DA H2'' H 1 2.673 0.001 . . . . . . A 14 DA H2'' . 36375 1 97 . 1 . 1 14 14 DA H3' H 1 4.813 0.000 . 1 . . . . A 14 DA H3' . 36375 1 98 . 1 . 1 14 14 DA H4' H 1 4.242 0.001 . 1 . . . . A 14 DA H4' . 36375 1 99 . 1 . 1 14 14 DA H8 H 1 7.886 0.001 . 1 . . . . A 14 DA H8 . 36375 1 100 . 1 . 1 15 15 DG H1 H 1 12.707 0.004 . 1 . . . . A 15 DG H1 . 36375 1 101 . 1 . 1 15 15 DG H1' H 1 5.247 0.001 . 1 . . . . A 15 DG H1' . 36375 1 102 . 1 . 1 15 15 DG H2' H 1 2.216 0.002 . . . . . . A 15 DG H2' . 36375 1 103 . 1 . 1 15 15 DG H2'' H 1 2.080 0.001 . . . . . . A 15 DG H2'' . 36375 1 104 . 1 . 1 15 15 DG H3' H 1 4.664 0.001 . 1 . . . . A 15 DG H3' . 36375 1 105 . 1 . 1 15 15 DG H4' H 1 4.170 0.001 . 1 . . . . A 15 DG H4' . 36375 1 106 . 1 . 1 15 15 DG H8 H 1 7.775 0.001 . 1 . . . . A 15 DG H8 . 36375 1 107 . 1 . 1 16 16 DC H1' H 1 5.130 0.001 . 1 . . . . A 16 DC H1' . 36375 1 108 . 1 . 1 16 16 DC H2' H 1 1.447 0.001 . . . . . . A 16 DC H2' . 36375 1 109 . 1 . 1 16 16 DC H2'' H 1 2.003 0.001 . . . . . . A 16 DC H2'' . 36375 1 110 . 1 . 1 16 16 DC H3' H 1 4.336 0.002 . 1 . . . . A 16 DC H3' . 36375 1 111 . 1 . 1 16 16 DC H4' H 1 4.005 0.002 . 1 . . . . A 16 DC H4' . 36375 1 112 . 1 . 1 16 16 DC H5 H 1 4.269 0.006 . 1 . . . . A 16 DC H5 . 36375 1 113 . 1 . 1 16 16 DC H6 H 1 6.398 0.001 . 1 . . . . A 16 DC H6 . 36375 1 114 . 1 . 1 16 16 DC H41 H 1 6.257 0.002 . . . . . . A 16 DC H41 . 36375 1 115 . 1 . 1 16 16 DC H42 H 1 8.019 0.002 . . . . . . A 16 DC H42 . 36375 1 116 . 1 . 1 17 17 DG H1 H 1 13.546 0.000 . 1 . . . . A 17 DG H1 . 36375 1 117 . 1 . 1 17 17 DG H1' H 1 5.976 0.001 . 1 . . . . A 17 DG H1' . 36375 1 118 . 1 . 1 17 17 DG H2' H 1 2.706 0.000 . . . . . . A 17 DG H2' . 36375 1 119 . 1 . 1 17 17 DG H2'' H 1 3.174 0.003 . . . . . . A 17 DG H2'' . 36375 1 120 . 1 . 1 17 17 DG H3' H 1 5.012 0.000 . 1 . . . . A 17 DG H3' . 36375 1 121 . 1 . 1 17 17 DG H4' H 1 4.339 0.001 . 1 . . . . A 17 DG H4' . 36375 1 122 . 1 . 1 17 17 DG H8 H 1 7.627 0.002 . 1 . . . . A 17 DG H8 . 36375 1 123 . 1 . 1 18 18 DG H1 H 1 11.486 0.001 . 1 . . . . A 18 DG H1 . 36375 1 124 . 1 . 1 18 18 DG H1' H 1 5.775 0.001 . 1 . . . . A 18 DG H1' . 36375 1 125 . 1 . 1 18 18 DG H2' H 1 3.110 0.000 . . . . . . A 18 DG H2' . 36375 1 126 . 1 . 1 18 18 DG H2'' H 1 2.753 0.001 . . . . . . A 18 DG H2'' . 36375 1 127 . 1 . 1 18 18 DG H3' H 1 4.958 0.001 . 1 . . . . A 18 DG H3' . 36375 1 128 . 1 . 1 18 18 DG H4' H 1 4.297 0.001 . 1 . . . . A 18 DG H4' . 36375 1 129 . 1 . 1 18 18 DG H8 H 1 7.405 0.003 . 1 . . . . A 18 DG H8 . 36375 1 130 . 1 . 1 19 19 DG H1 H 1 11.672 0.001 . 1 . . . . A 19 DG H1 . 36375 1 131 . 1 . 1 19 19 DG H1' H 1 5.957 0.000 . 1 . . . . A 19 DG H1' . 36375 1 132 . 1 . 1 19 19 DG H2' H 1 2.224 0.001 . . . . . . A 19 DG H2' . 36375 1 133 . 1 . 1 19 19 DG H2'' H 1 2.341 0.001 . . . . . . A 19 DG H2'' . 36375 1 134 . 1 . 1 19 19 DG H3' H 1 4.739 0.001 . 1 . . . . A 19 DG H3' . 36375 1 135 . 1 . 1 19 19 DG H4' H 1 4.272 0.002 . 1 . . . . A 19 DG H4' . 36375 1 136 . 1 . 1 19 19 DG H8 H 1 7.737 0.001 . 1 . . . . A 19 DG H8 . 36375 1 137 . 1 . 1 20 20 DG H1' H 1 6.021 0.001 . 1 . . . . A 20 DG H1' . 36375 1 138 . 1 . 1 20 20 DG H2' H 1 2.669 0.001 . . . . . . A 20 DG H2' . 36375 1 139 . 1 . 1 20 20 DG H2'' H 1 2.692 0.001 . . . . . . A 20 DG H2'' . 36375 1 140 . 1 . 1 20 20 DG H3' H 1 4.714 0.000 . 1 . . . . A 20 DG H3' . 36375 1 141 . 1 . 1 20 20 DG H4' H 1 4.536 0.001 . 1 . . . . A 20 DG H4' . 36375 1 142 . 1 . 1 20 20 DG H8 H 1 7.928 0.001 . 1 . . . . A 20 DG H8 . 36375 1 143 . 1 . 1 21 21 DT H1' H 1 5.721 0.001 . 1 . . . . A 21 DT H1' . 36375 1 144 . 1 . 1 21 21 DT H2' H 1 1.965 0.000 . . . . . . A 21 DT H2' . 36375 1 145 . 1 . 1 21 21 DT H2'' H 1 1.766 0.001 . . . . . . A 21 DT H2'' . 36375 1 146 . 1 . 1 21 21 DT H3' H 1 4.331 0.001 . 1 . . . . A 21 DT H3' . 36375 1 147 . 1 . 1 21 21 DT H4' H 1 4.055 0.001 . 1 . . . . A 21 DT H4' . 36375 1 148 . 1 . 1 21 21 DT H6 H 1 7.111 0.000 . 1 . . . . A 21 DT H6 . 36375 1 149 . 1 . 1 21 21 DT H71 H 1 1.685 0.001 . 1 . . . . A 21 DT H71 . 36375 1 150 . 1 . 1 21 21 DT H72 H 1 1.685 0.001 . 1 . . . . A 21 DT H72 . 36375 1 151 . 1 . 1 21 21 DT H73 H 1 1.685 0.001 . 1 . . . . A 21 DT H73 . 36375 1 152 . 1 . 1 22 22 DC H1' H 1 5.748 0.001 . 1 . . . . A 22 DC H1' . 36375 1 153 . 1 . 1 22 22 DC H2' H 1 1.534 0.001 . . . . . . A 22 DC H2' . 36375 1 154 . 1 . 1 22 22 DC H2'' H 1 2.148 0.001 . . . . . . A 22 DC H2'' . 36375 1 155 . 1 . 1 22 22 DC H3' H 1 4.062 0.001 . 1 . . . . A 22 DC H3' . 36375 1 156 . 1 . 1 22 22 DC H4' H 1 3.923 0.001 . 1 . . . . A 22 DC H4' . 36375 1 157 . 1 . 1 22 22 DC H5 H 1 4.944 0.001 . 1 . . . . A 22 DC H5 . 36375 1 158 . 1 . 1 22 22 DC H6 H 1 6.640 0.001 . 1 . . . . A 22 DC H6 . 36375 1 159 . 1 . 1 23 23 DG H1' H 1 5.830 0.001 . 1 . . . . A 23 DG H1' . 36375 1 160 . 1 . 1 23 23 DG H2' H 1 1.604 0.002 . . . . . . A 23 DG H2' . 36375 1 161 . 1 . 1 23 23 DG H2'' H 1 2.958 0.001 . . . . . . A 23 DG H2'' . 36375 1 162 . 1 . 1 23 23 DG H3' H 1 4.842 0.001 . 1 . . . . A 23 DG H3' . 36375 1 163 . 1 . 1 23 23 DG H4' H 1 3.806 0.001 . 1 . . . . A 23 DG H4' . 36375 1 164 . 1 . 1 23 23 DG H8 H 1 7.843 0.001 . 1 . . . . A 23 DG H8 . 36375 1 165 . 1 . 1 24 24 DG H1 H 1 11.713 0.000 . 1 . . . . A 24 DG H1 . 36375 1 166 . 1 . 1 24 24 DG H1' H 1 6.164 0.001 . 1 . . . . A 24 DG H1' . 36375 1 167 . 1 . 1 24 24 DG H2' H 1 3.677 0.001 . . . . . . A 24 DG H2' . 36375 1 168 . 1 . 1 24 24 DG H2'' H 1 3.104 0.001 . . . . . . A 24 DG H2'' . 36375 1 169 . 1 . 1 24 24 DG H3' H 1 4.982 0.001 . 1 . . . . A 24 DG H3' . 36375 1 170 . 1 . 1 24 24 DG H4' H 1 4.497 0.001 . 1 . . . . A 24 DG H4' . 36375 1 171 . 1 . 1 24 24 DG H8 H 1 7.553 0.003 . 1 . . . . A 24 DG H8 . 36375 1 172 . 1 . 1 25 25 DG H1 H 1 11.783 0.001 . 1 . . . . A 25 DG H1 . 36375 1 173 . 1 . 1 25 25 DG H1' H 1 5.676 0.001 . 1 . . . . A 25 DG H1' . 36375 1 174 . 1 . 1 25 25 DG H2' H 1 2.733 0.001 . . . . . . A 25 DG H2' . 36375 1 175 . 1 . 1 25 25 DG H2'' H 1 2.524 0.001 . . . . . . A 25 DG H2'' . 36375 1 176 . 1 . 1 25 25 DG H3' H 1 5.048 0.001 . 1 . . . . A 25 DG H3' . 36375 1 177 . 1 . 1 25 25 DG H4' H 1 4.469 0.001 . 1 . . . . A 25 DG H4' . 36375 1 178 . 1 . 1 25 25 DG H8 H 1 8.075 0.001 . 1 . . . . A 25 DG H8 . 36375 1 179 . 1 . 1 26 26 DC H1' H 1 6.651 0.001 . 1 . . . . A 26 DC H1' . 36375 1 180 . 1 . 1 26 26 DC H2' H 1 2.381 0.001 . . . . . . A 26 DC H2' . 36375 1 181 . 1 . 1 26 26 DC H2'' H 1 2.381 0.001 . . . . . . A 26 DC H2'' . 36375 1 182 . 1 . 1 26 26 DC H3' H 1 4.716 0.001 . 1 . . . . A 26 DC H3' . 36375 1 183 . 1 . 1 26 26 DC H4' H 1 4.271 0.002 . 1 . . . . A 26 DC H4' . 36375 1 184 . 1 . 1 26 26 DC H5 H 1 5.878 0.003 . 1 . . . . A 26 DC H5 . 36375 1 185 . 1 . 1 26 26 DC H6 H 1 7.851 0.003 . 1 . . . . A 26 DC H6 . 36375 1 186 . 1 . 1 26 26 DC H41 H 1 7.793 0.002 . . . . . . A 26 DC H41 . 36375 1 stop_ save_